WormBase Tree Display for Expr_pattern: Expr6726
expand all nodes | collapse all nodes | view schema
Expr6726 | Expression_of (2) | ||
---|---|---|---|
Homol | Homol_homol | T21B10:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term (21) | |||
Type | Reporter_gene | [T21B10.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTGCTCTACGCAAGTTATTTCAG] 3' and primer B 5' [TCTTGGTGATTGGGATCCTG] 3'. | |
Pattern | Adult Expression: pharynx; intestine; rectal gland cells; anal depressor muscle; rectal epithelium; Reproductive System; distal tip cell; uterine muscle; vulval muscle; spermatheca; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells in head; | ||
Larval Expression: pharynx; intestine; rectal gland cells; anal depressor muscle; rectal epithelium; Reproductive System; distal tip cell; developing vulva; developing spermatheca; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; amphid socket cells; tail neurons; unidentified cells; unidentified cells in head; | |||
Picture | WBPicture0000006432 | ||
WBPicture0000006433 | |||
WBPicture0000006434 | |||
WBPicture0000006435 | |||
WBPicture0000006436 | |||
WBPicture0000006437 | |||
Remark | Also expressed in (comments from author) : Unidentified cells in head, are possibly nuclei of the nerve ring. And what we thought were arcade cells, may actually be the 2 amphid socket cells. | ||
Strain: BC11318 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002556 |