Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6694

expand all nodes | collapse all nodes | view schema

Name Class

Expr6694Expression_of (2)
HomolHomol_homolT14F9:Expr
Expression_dataLife_stageWBls:0000041
WBls:0000023
Anatomy_term (11)
TypeReporter_gene[vha-15::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCATTGTTTTCCATTGTTTTATCA] 3' and primer B 5' [TGAGGAACTTCCGCGATT] 3'.
PatternAdult Expression: pharynx; intestine; vulval muscle; body wall muscle; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons;
Larval Expression: pharynx; intestine; body wall muscle; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons;
RemarkStrain: BC14406
ReferenceWBPaper00006525
TransgeneWBTransgene00003541