WormBase Tree Display for Expr_pattern: Expr6678
expand all nodes | collapse all nodes | view schema
Expr6678 | Expression_of | Gene | WBGene00005163 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00005163 | ||
Homol | Homol_homol | C18F10:Expr | |
Expression_data | Life_stage (2) | ||
Anatomy_term | WBbt:0005107 | ||
WBbt:0005735 | |||
Type | Reporter_gene | [srg-5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCGGTATTTCTGACAGAGACTCA] 3' and primer B 5' [TTCAAATTCTCAGGCAAAGGA] 3'. | |
Pattern | Adult Expression: Nervous System; labial sensilla; | ||
Larval Expression: Nervous System; labial sensilla; | |||
Remark | Also expressed in (comments from author) : Embryo incomplete. To be updated. | ||
Strain: BC12021 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002794 |