Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6668

expand all nodes | collapse all nodes | view schema

Name Class

Expr6668Expression_ofGeneWBGene00004897
Reflects_endogenous_expression_ofWBGene00004897
HomolHomol_homolT10H9:Expr
Expression_dataLife_stageWBls:0000041
WBls:0000023
Anatomy_term (21)
TypeReporter_gene[snb-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GATGTATCCTGATGTCCCGATT] 3' and primer B 5' [TCGTCAAGATGGTCTTATCCG] 3'.
PatternAdult Expression: pharynx; arcade cells; Reproductive System; distal tip cell; vulval muscle; spermatheca; gonad sheath cells; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons; unidentified cells in tail ;
Larval Expression: pharynx; arcade cells; Reproductive System; developing gonad; body wall muscle; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; neurons along body; tail neurons; unidentified cells in tail ;
Picture (6)
RemarkStrain: BC11116
ReferenceWBPaper00006525
TransgeneWBTransgene00002496