WormBase Tree Display for Expr_pattern: Expr6634
expand all nodes | collapse all nodes | view schema
| Expr6634 | Expression_of | Gene | WBGene00002976 |
|---|---|---|---|
| Reflects_endogenous_expression_of | WBGene00002976 | ||
| Homol | Homol_homol | T07H6:Expr | |
| Expression_data | Life_stage | WBls:0000041 | |
| WBls:0000023 | |||
| Anatomy_term | WBbt:0005735 | ||
| WBbt:0005772 | |||
| WBbt:0006759 | |||
| Type | Reporter_gene | [T07H6.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CAATCTTCGTCTGCTATACAC] 3' and primer B 5' [CCCGTGACGATTATCGATTT] 3'. | |
| Pattern | Adult Expression: intestine - . cells; Nervous System; tail neurons; unidentified cells; | ||
| Larval Expression: Nervous System; tail neurons; unidentified cells; | |||
| Remark | Also expressed in (comments from author) : Embryo incomplete. To be updated. | ||
| Strain: BC10343 | |||
| Reference | WBPaper00006525 | ||
| Transgene | WBTransgene00002202 |
