WormBase Tree Display for Expr_pattern: Expr6630
expand all nodes | collapse all nodes | view schema
Expr6630 | Homol | Homol_homol | T07E3:Expr |
---|---|---|---|
Expression_data (2) | |||
Type | Reporter_gene | [T07E3.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CATCCAGAGTTGTGAAAAGTTCC] 3' and primer B 5' [TTGAGCTCTTTACGGATTTTTCTT] 3'. | |
Pattern | Adult Expression: Nervous System; head neurons; | ||
Larval Expression: Nervous System; head neurons; | |||
Picture | WBPicture0000006278 | ||
Remark | Also expressed in (comments from author) : No comments. | ||
Strain: BC14642 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00003640 | ||
Historical_gene | WBGene00020312 | Note: This object originally referred to a gene (WBGene00020312) that has been suppressed. Please interpret with discretion. |