Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6630

expand all nodes | collapse all nodes | view schema

Name Class

Expr6630HomolHomol_homolT07E3:Expr
Expression_data (2)
TypeReporter_gene[T07E3.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CATCCAGAGTTGTGAAAAGTTCC] 3' and primer B 5' [TTGAGCTCTTTACGGATTTTTCTT] 3'.
PatternAdult Expression: Nervous System; head neurons;
Larval Expression: Nervous System; head neurons;
PictureWBPicture0000006278
RemarkAlso expressed in (comments from author) : No comments.
Strain: BC14642
ReferenceWBPaper00006525
TransgeneWBTransgene00003640
Historical_geneWBGene00020312Note: This object originally referred to a gene (WBGene00020312) that has been suppressed. Please interpret with discretion.