WormBase Tree Display for Expr_pattern: Expr6626
expand all nodes | collapse all nodes | view schema
Expr6626 | Expression_of | Gene | WBGene00003384 | ||
---|---|---|---|---|---|
Reflects_endogenous_expression_of | WBGene00003384 | ||||
Homol | Homol_homol | F09B9:Expr | |||
Expression_data | Life_stage | WBls:0000041 | |||
WBls:0000023 | |||||
Anatomy_term | WBbt:0005741 | Partial | |||
Remark | unidentified cells | ||||
Type | Reporter_gene | [moc-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGATGCAATTGTGAAAATAAATAA] 3' and primer B 5' [GGTGATGAGCAGCGATTTCT] 3'. | |||
Pattern | Adult Expression: unidentified cells in tail ; | ||||
Larval Expression: unidentified cells in tail ; | |||||
Remark | Also expressed in (comments from author) : Unidentified cells in the tail. | ||||
Strain: BC10813 | |||||
Reference | WBPaper00006525 | ||||
Transgene | WBTransgene00002343 |