WormBase Tree Display for Expr_pattern: Expr6558
expand all nodes | collapse all nodes | view schema
| Expr6558 | Expression_of | Gene | WBGene00020140 |
|---|---|---|---|
| Reflects_endogenous_expression_of | WBGene00020140 | ||
| Homol | Homol_homol | T01B11:Expr | |
| Expression_data | Life_stage | WBls:0000041 | |
| WBls:0000023 | |||
| Anatomy_term | WBbt:0003679 | ||
| WBbt:0005394 | |||
| WBbt:0005735 | |||
| WBbt:0006751 | |||
| WBbt:0006753 | |||
| WBbt:0006759 | |||
| Type | Reporter_gene | [T01B11.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTTGCGGCTACAGTGTTCT] 3' and primer B 5' [CTTACCTCCAGACATGCTTGC] 3'. | |
| Pattern | Adult Expression: Nervous System; head neurons; amphids; neurons along body; tail neurons; phasmids; | ||
| Larval Expression: Nervous System; head neurons; amphids; neurons along body; tail neurons; phasmids; | |||
| Remark | Also expressed in (comments from author) : Embryo incomplete. To be updated. | ||
| Strain: BC14673 | |||
| Reference | WBPaper00006525 | ||
| Transgene | WBTransgene00004590 |
