Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6538

expand all nodes | collapse all nodes | view schema

Name Class

Expr6538Expression_ofGeneWBGene00020098
Reflects_endogenous_expression_ofWBGene00020098
HomolHomol_homolR144:Expr
Expression_data (2)
TypeReporter_gene[R144.10::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CAAAAACATTTGAAGAGATTGTGA] 3' and primer B 5' [CCGGACATATCGTCTTGTCG] 3'.
PatternAdult Expression: intestine; Nervous System; head neurons; amphids; neurons along body; tail neurons; phasmids; unidentified cells in head; unidentified cells in tail ;
Larval Expression: intestine; rectal gland cells; Nervous System; head neurons; amphids; neurons along body; tail neurons; phasmids; unidentified cells in head; unidentified cells in tail ;
RemarkStrain: BC12750
ReferenceWBPaper00006525
TransgeneWBTransgene00004469