WormBase Tree Display for Expr_pattern: Expr6480
expand all nodes | collapse all nodes | view schema
Expr6480 | Expression_of | Gene | WBGene00019944 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00019944 | ||
Homol | Homol_homol | R07G3:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
Anatomy_term (7) | |||
Type | Reporter_gene | [R07G3.8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCAGTTGGATTTCCCTTTCCT] 3' and primer B 5' [TTCTGCGAATCATTAAGCTGAG] 3'. | |
Pattern | Adult Expression: Reproductive System; vulval muscle; Nervous System; ventral nerve cord; head neurons; neurons along body; tail neurons; | ||
Remark | Also expressed in (comments from author) : incomplete. Will be updated. | ||
Strain: BC10340 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002200 |