Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6461

expand all nodes | collapse all nodes | view schema

Name Class

Expr6461Expression_ofGeneWBGene00019888
Reflects_endogenous_expression_ofWBGene00019888
HomolHomol_homolR05F9:Expr
Expression_dataLife_stage (2)
Anatomy_term (14)
TypeReporter_gene[R05F9.1a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAATTTCCGCTTTTCACCG] 3' and primer B 5' [ATAAAACGAGAAAACAGATGGAGC] 3'.
PatternAdult Expression: pharynx; pharyngeal-intestinal valve; intestine; stomato-intestinal muscle; anal depressor muscle; Reproductive System; vulval muscle; spermatheca; body wall muscle; hypodermis; Nervous System; neurons along body; tail neurons; unidentified cells;
Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; body wall muscle; hypodermis; Nervous System; neurons along body; tail neurons; unidentified cells;
RemarkStrain: BC12361
ReferenceWBPaper00006525
TransgeneWBTransgene00004433