WormBase Tree Display for Expr_pattern: Expr6454
expand all nodes | collapse all nodes | view schema
| Expr6454 | Expression_of | Gene | WBGene00005114 | ||
|---|---|---|---|---|---|
| Reflects_endogenous_expression_of | WBGene00005114 | ||||
| Homol | Homol_homol | R04D3:Expr | |||
| Expression_data | Life_stage | WBls:0000041 | |||
| WBls:0000023 | |||||
| Anatomy_term | WBbt:0005735 | ||||
| WBbt:0005772 | Partial | ||||
| Remark | ant and post cells | ||||
| WBbt:0006751 | |||||
| Type | Reporter_gene | [srd-36::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGGAAATGTGGACGTATGGA] 3' and primer B 5' [ACCAAAGGGCGTGTAGTTTCT] 3'. | |||
| Pattern | Adult Expression: intestine - ant and post cells; Nervous System; head neurons; | ||||
| Larval Expression: intestine - ant and post cells; Nervous System; head neurons; | |||||
| Remark | Strain: BC15859 | ||||
| Reference | WBPaper00006525 | ||||
| Transgene | WBTransgene00004110 |
