WormBase Tree Display for Expr_pattern: Expr6338
expand all nodes | collapse all nodes | view schema
Expr6338 | Expression_of | Gene | WBGene00001743 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00001743 | ||
Homol | Homol_homol | K06H7:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term (4) | |||
Type | Reporter_gene | [grp-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GATTAGGGCTGTGCAGCAA] 3' and primer B 5' [TGAATACCGCGATGAGATTT] 3'. | |
Pattern | Adult Expression: intestine; Nervous System; head neurons; unidentified cells; | ||
Larval Expression: intestine; rectal gland cells; Nervous System; head neurons; unidentified cells; | |||
Remark | Also expressed in (comments from author) : Very low intensity GFP.Embryo incomplete. To be updated. | ||
Strain: BC10249 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002156 |