WormBase Tree Display for Expr_pattern: Expr6325

Expr6325 Expression_of: Gene: WBGene00000254
    Reflects_endogenous_expression_of: WBGene00000254
  Homol: Homol_homol: K04F10:Expr
  Expression_data: Life_stage: WBls:0000041
    Anatomy_term: WBbt:0005739 Partial
        Remark: unidentified cells
      WBbt:0005747
      WBbt:0005772
      WBbt:0005821
  Type: Reporter_gene: [bli-4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGTGTATAACTGGTGGCCAATATC] 3' and primer B 5' [ATCACGCGTTTGAGAATAAATGT] 3'.
  Pattern: Adult Expression: intestine; Reproductive System; vulval muscle; unidentified cells in head;
  Remark: Also expressed in (comments from author) : Incomplete. To be updated.
    Strain: BC11763
  Reference: WBPaper00006525
  Transgene: WBTransgene00002685