Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6299

expand all nodes | collapse all nodes | view schema

Name Class

Expr6299Expression_ofGeneWBGene00004424
Reflects_endogenous_expression_ofWBGene00004424
HomolHomol_homolJC8:Expr
Expression_dataLife_stageWBls:0000041
WBls:0000023
Anatomy_term (26)
TypeReporter_gene[rpl-12::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTGAAGAGACGCAGGTGAGTT] 3' and primer B 5' [CTTTGGTGGCATGATGAGTG] 3'.
PatternAdult Expression: pharynx; pharyngeal gland cells; intestine; stomato-intestinal muscle; anal depressor muscle; anal sphincter; rectal epithelium; Reproductive System; vulval muscle; body wall muscle; hypodermis; seam cells; excretory cell; excretory gland cells; coelomocytes; Nervous System; nerve ring; ventral nerve cord; head neurons; amphids; neurons along body; tail neurons; unidentified cells;
Larval Expression: pharynx; pharyngeal gland cells; pharyngeal-intestinal valve; intestine - posterior cells; rectal gland cells; stomato-intestinal muscle; anal depressor muscle; anal sphincter; rectal epithelium; Reproductive System; developing uterus; body wall muscle; hypodermis; seam cells; excretory cell; excretory gland cells; Nervous System; nerve ring; ventral nerve cord; head neurons; amphids; neurons along body; tail neurons; unidentified cells;
Picture (6)
RemarkAlso expressed in (comments from author) : ubiquitous expressionMosaic population.
Strain: BC14251
ReferenceWBPaper00006525
TransgeneWBTransgene00003466