WormBase Tree Display for Expr_pattern: Expr6253
expand all nodes | collapse all nodes | view schema
Expr6253 | Expression_of | Gene | WBGene00004338 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00004338 | ||
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term | WBbt:0005735 | ||
WBbt:0005772 | |||
WBbt:0006751 | |||
Type | Reporter_gene | [rfc-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTGAATTTCCCGCCAAAA] 3' and primer B 5' [TCCGACTTTGAGATAGCTGGA] 3'. | |
Pattern | Adult Expression: Nervous System; head neurons; | ||
Larval Expression: intestine; Nervous System; head neurons; | |||
Picture | WBPicture0000009369 | ||
Remark | Also expressed in (comments from author) : Note: primers are not unique and produce multiple products.Mosaic population. | ||
Strain: BC14248 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00003465 |