WormBase Tree Display for Expr_pattern: Expr6246
expand all nodes | collapse all nodes | view schema
Expr6246 | Expression_of | Gene | WBGene00019028 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00019028 | ||
Homol | Homol_homol | F58A6:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term | WBbt:0005735 | ||
WBbt:0005772 | |||
WBbt:0006751 | |||
Type | Reporter_gene | [srb-13::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGCTCGTTTTGTTGTAATTCTGTG] 3' and primer B 5' [TAATTCCCGCGATTTCAGA] 3'. | |
Pattern (2) | |||
Picture | WBPicture0000009368 | ||
Remark | Also expressed in (comments from author) : ASI + ASK amphid neurons. Brightest in ASK, weak in ASI and one other non-DiI stained head neuron pair (Hobert Lab 2005) | ||
Strain: BC14700 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00003667 |