WormBase Tree Display for Expr_pattern: Expr6244
expand all nodes | collapse all nodes | view schema
| Expr6244 | Expression_of | Gene | WBGene00010220 |
|---|---|---|---|
| Reflects_endogenous_expression_of | WBGene00010220 | ||
| Homol | Homol_homol | F57G9:Expr | |
| Expression_data | Life_stage | WBls:0000041 | |
| WBls:0000023 | |||
| Anatomy_term | WBbt:0005733 | ||
| WBbt:0005735 | |||
| WBbt:0005772 | |||
| WBbt:0005813 | |||
| WBbt:0006751 | |||
| Type | Reporter_gene | [F57G9.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AATCGCAAGTTTCCTCCAAAT] 3' and primer B 5' [TAGCCAATATCGCAGATCACC] 3'. | |
| Pattern | Adult Expression: body wall muscle; hypodermis; Nervous System; head neurons; | ||
| Larval Expression: intestine; body wall muscle; hypodermis; Nervous System; head neurons; | |||
| Picture | WBPicture0000009366 | ||
| WBPicture0000009367 | |||
| Remark | Also expressed in (comments from author) : Embryo incomplete. To be updated. | ||
| Strain: BC12200 | |||
| Reference | WBPaper00006525 | ||
| Transgene | WBTransgene00002862 |
