WormBase Tree Display for Expr_pattern: Expr6233
expand all nodes | collapse all nodes | view schema
Expr6233 | Expression_of | Gene | WBGene00004505 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00004505 | ||
Homol | Homol_homol | F56H1:Expr | |
Expression_data | Life_stage (2) | ||
Anatomy_term (14) | |||
Type | Reporter_gene | [rpt-5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCATGTTGCACCTTTTTATTCG] 3' and primer B 5' [TGTTTGCGAGATTGTACTGCTT] 3'. | |
Pattern | Adult Expression: intestine; Reproductive System; spermatheca; gonad sheath cells; body wall muscle; unidentified cells in head; unidentified cells in tail ; | ||
Larval Expression: pharynx; intestine; stomato-intestinal muscle; anal depressor muscle; Reproductive System; developing gonad; body wall muscle; Nervous System; nerve ring; unidentified cells in head; unidentified cells in tail ; | |||
Remark | Also expressed in (comments from author) : Embryo incomplete. To be updated. | ||
Strain: BC10561 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002312 |