Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6233

expand all nodes | collapse all nodes | view schema

Name Class

Expr6233Expression_ofGeneWBGene00004505
Reflects_endogenous_expression_ofWBGene00004505
HomolHomol_homolF56H1:Expr
Expression_dataLife_stage (2)
Anatomy_term (14)
TypeReporter_gene[rpt-5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCATGTTGCACCTTTTTATTCG] 3' and primer B 5' [TGTTTGCGAGATTGTACTGCTT] 3'.
PatternAdult Expression: intestine; Reproductive System; spermatheca; gonad sheath cells; body wall muscle; unidentified cells in head; unidentified cells in tail ;
Larval Expression: pharynx; intestine; stomato-intestinal muscle; anal depressor muscle; Reproductive System; developing gonad; body wall muscle; Nervous System; nerve ring; unidentified cells in head; unidentified cells in tail ;
RemarkAlso expressed in (comments from author) : Embryo incomplete. To be updated.
Strain: BC10561
ReferenceWBPaper00006525
TransgeneWBTransgene00002312