WormBase Tree Display for Expr_pattern: Expr6229
expand all nodes | collapse all nodes | view schema
| Expr6229 | Homol | Homol_homol | F56F3:Expr |
|---|---|---|---|
| Expression_data | Life_stage | WBls:0000041 | |
| WBls:0000023 | |||
| Anatomy_term | WBbt:0005735 | ||
| WBbt:0006751 | |||
| WBbt:0006759 | |||
| Type | Reporter_gene | [F56F3.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGCAAACACACACACATAAAAGAC] 3' and primer B 5' [CCGCTGGTGCTTGATCTT] 3'. | |
| Pattern | Adult Expression: Nervous System; head neurons; tail neurons; | ||
| Larval Expression: Nervous System; head neurons; tail neurons; | |||
| Picture | WBPicture0000005601 | ||
| WBPicture0000005602 | |||
| Remark | Strain: BC12871 | ||
| Reference | WBPaper00006525 | ||
| Transgene | WBTransgene00003039 | ||
| Historical_gene | WBGene00010154 | Note: This object originally referred to a gene (WBGene00010154) that is now considered dead. Please interpret with discretion. |
