WormBase Tree Display for Expr_pattern: Expr6229
expand all nodes | collapse all nodes | view schema
Expr6229 | Homol | Homol_homol | F56F3:Expr |
---|---|---|---|
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term | WBbt:0005735 | ||
WBbt:0006751 | |||
WBbt:0006759 | |||
Type | Reporter_gene | [F56F3.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGCAAACACACACACATAAAAGAC] 3' and primer B 5' [CCGCTGGTGCTTGATCTT] 3'. | |
Pattern | Adult Expression: Nervous System; head neurons; tail neurons; | ||
Larval Expression: Nervous System; head neurons; tail neurons; | |||
Picture | WBPicture0000005601 | ||
WBPicture0000005602 | |||
Remark | Strain: BC12871 | ||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00003039 | ||
Historical_gene | WBGene00010154 | Note: This object originally referred to a gene (WBGene00010154) that is now considered dead. Please interpret with discretion. |