Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6221

expand all nodes | collapse all nodes | view schema

Name Class

Expr6221Expression_of (2)
HomolHomol_homolF56D12:Expr
Expression_dataLife_stageWBls:0000041
WBls:0000023
Anatomy_term (18)
TypeReporter_gene[vig-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCACCACCAAACGAGTTTTTC] 3' and primer B 5' [TATTCAGTGCTGATTTTTGCTGTT] 3'.
PatternAdult Expression: pharynx; intestine; rectal epithelium; Reproductive System; distal tip cell; uterine muscle; vulval muscle; spermatheca; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons;
Larval Expression: pharynx; intestine; rectal epithelium; Reproductive System; distal tip cell; developing vulva; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons;
RemarkStrain: BC14245
ReferenceWBPaper00006525
TransgeneWBTransgene00003463