WormBase Tree Display for Expr_pattern: Expr6207
expand all nodes | collapse all nodes | view schema
Expr6207 | Expression_of | Gene | WBGene00001935 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00001935 | ||
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term (3) | |||
Type | Reporter_gene | [his-61::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAACCAATTACCGAACCCAAC] 3' and primer B 5' [TCCACGTCCAGAGATGATGA] 3'. | |
Pattern | Adult Expression: Nervous System; head neurons; | ||
Larval Expression: intestine; Nervous System; head neurons; | |||
Picture | WBPicture0000005580 | ||
WBPicture0000005581 | |||
Remark | Also expressed in (comments from author) : Note: primers are not unique and produce 3 products. | ||
Strain: BC14500 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00003578 |