WormBase Tree Display for Expr_pattern: Expr6125
expand all nodes | collapse all nodes | view schema
Expr6125 | Expression_of | Gene | WBGene00005039 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00005039 | ||
Homol | Homol_homol | F49E12:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term | WBbt:0005394 | ||
WBbt:0005733 | |||
WBbt:0005735 | |||
WBbt:0005753 | |||
WBbt:0006751 | |||
Type | Reporter_gene | [sra-13::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGTGTTTTCGAATCGGTTACTG] 3' and primer B 5' [GAGGAAGGAGTTGCGATATTTTT] 3'. | |
Pattern | Adult Expression: hypodermis; seam cells; Nervous System; head neurons; amphids; | ||
Larval Expression: hypodermis; seam cells; Nervous System; head neurons; amphids; | |||
Remark | Also expressed in (comments from author) : AWA + AWC amphid neurons (Thomas Lab 2005). Embryo incomplete. To be updated. | ||
Strain: BC13517 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00004426 |