Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6037

expand all nodes | collapse all nodes | view schema

Name Class

Expr6037Expression_of (2)
HomolHomol_homolF42A8:Expr
Expression_dataLife_stageWBls:0000041
WBls:0000023
Anatomy_term (16)
TypeReporter_gene[tag-55::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTCGCTAATTTTGAACAATAGAA] 3' and primer B 5' [GGGCCAAGATCTGAGATTTATTC] 3'.
PatternAdult Expression: pharynx; intestine; Reproductive System; vulva other; spermatheca; gonad sheath cells; body wall muscle; hypodermis; excretory cell; Nervous System; ventral nerve cord; head neurons; tail neurons; unidentified cells in head; unidentified cells in body ;unidentified cells in tail ;
Larval Expression: pharynx; intestine; Reproductive System; developing vulva; body wall muscle; hypodermis; excretory cell; Nervous System; ventral nerve cord; head neurons; tail neurons; unidentified cells in head; unidentified cells in body ;unidentified cells in tail ;
RemarkStrain: BC14273
ReferenceWBPaper00006525
TransgeneWBTransgene00003478