WormBase Tree Display for Expr_pattern: Expr6016
expand all nodes | collapse all nodes | view schema
Expr6016 | Expression_of | Gene | WBGene00009583 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00009583 | ||
Homol | Homol_homol | F40F9:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term | WBbt:0003681 | ||
WBbt:0004292 | |||
WBbt:0005300 | |||
WBbt:0005735 | |||
WBbt:0005772 | |||
WBbt:0005788 | |||
WBbt:0005800 | |||
WBbt:0006749 | |||
WBbt:0006751 | |||
WBbt:0006759 | |||
Type | Reporter_gene | [F40F9.6a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GATGCCGGATACTGACGG] 3' and primer B 5' [TGATTACTGGAATCGAAGGTTTG] 3'. | |
Pattern (2) | |||
Picture | WBPicture0000005155 | ||
WBPicture0000005156 | |||
Remark | Also expressed in (comments from author) : ubiquitous in embryo and freshly hatched L1s | ||
Strain: BC12513 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00004376 |