Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6009

expand all nodes | collapse all nodes | view schema

Name Class

Expr6009Expression_ofGeneWBGene00009587
Reflects_endogenous_expression_ofWBGene00009587
HomolHomol_homolF40F11:Expr
Expression_dataLife_stageWBls:0000041
WBls:0000023
Anatomy_term (20)
TypeReporter_gene[F40F11.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGCGCCATTAAGAAGTACAGTAAC] 3' and primer B 5' [TTGTTTCCGAATCATTATCTTGTT] 3'.
PatternAdult Expression: pharynx; anal depressor muscle; Reproductive System; uterus; vulval muscle; vulva other; spermatheca; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; lateral nerve cords; head neurons; unidentified cells in head; unidentified cells in tail ;
Larval Expression: pharynx; pharyngeal-intestinal valve; stomato-intestinal muscle; anal depressor muscle; Reproductive System; developing vulva; developing uterus; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; lateral nerve cords; head neurons; unidentified cells in head; unidentified cells in tail ;
Picture (6)
RemarkAlso expressed in (comments from author) : unidentified cells in head and tail, a lot of neural
Strain: BC12753
ReferenceWBPaper00006525
TransgeneWBTransgene00004468