WormBase Tree Display for Expr_pattern: Expr5984
expand all nodes | collapse all nodes | view schema
Expr5984 | Expression_of | Gene | WBGene00009514 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00009514 | ||
Homol | Homol_homol | F37H8:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term | WBbt:0005735 | ||
WBbt:0005747 | |||
WBbt:0005772 | |||
WBbt:0005799 | |||
WBbt:0005828 | |||
WBbt:0006748 | |||
WBbt:0006751 | |||
Type | Reporter_gene | [F37H8.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AATGTGTTGTGCACTTTTCCC] 3' and primer B 5' [ATGGTTGTGCTGATGTTAGGG] 3'. | |
Pattern | Adult Expression: intestine; Reproductive System; vulva other; gonad sheath cells; Nervous System; head neurons; | ||
Larval Expression: intestine; rectal gland cells; Reproductive System; developing vulva; gonad sheath cells; Nervous System; head neurons; | |||
Picture | WBPicture0000005116 | ||
WBPicture0000005117 | |||
WBPicture0000005118 | |||
WBPicture0000005119 | |||
WBPicture0000005120 | |||
Remark | Also expressed in (comments from author) : Second analysis, 5months later, showed reduced tissue expression (lost gonad sheath cells, developing vulva, and rectal gland cells) | ||
Strain: BC13660 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00003242 |