WormBase Tree Display for Expr_pattern: Expr5967
expand all nodes | collapse all nodes | view schema
Expr5967 | Expression_of | Gene | WBGene00009462 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00009462 | ||
Homol | Homol_homol | F36D1:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term | WBbt:0003679 | ||
WBbt:0005733 | |||
WBbt:0005735 | |||
WBbt:0006751 | |||
WBbt:0006759 | |||
Type | Reporter_gene | [sre-22::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAAGTGGGAAATAGGTAGAAAGGG] 3' and primer B 5' [GGATGAAAATTGCGATAATTG] 3'. | |
Pattern | Adult Expression: hypodermis; Nervous System; head neurons; neurons along body; tail neurons; | ||
Larval Expression: hypodermis; Nervous System; head neurons; neurons along body; tail neurons; | |||
Picture | WBPicture0000005092 | ||
WBPicture0000005093 | |||
WBPicture0000005094 | |||
Remark | Also expressed in (comments from author) : Ventral neuron(s) near tail may be the PVT interneuron, or the PVPL/R interneurons. | ||
Strain: BC14656 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00003648 |