WormBase Tree Display for Expr_pattern: Expr5899
expand all nodes | collapse all nodes | view schema
Expr5899 | Expression_of | Gene | WBGene00005048 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00005048 | ||
Homol | Homol_homol | F28C12:Expr | |
Expression_data (2) | |||
Type | Reporter_gene | [sra-22::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CGTACACCTCCACTCTGGACT] 3' and primer B 5' [TTTTCAGATCCAAAGGATGAAA] 3'. | |
Pattern | Adult Expression: Nervous System; head neurons; amphids; | ||
Larval Expression: Nervous System; head neurons; amphids; | |||
Picture | WBPicture0000009278 | ||
Remark | Also expressed in (comments from author) : ASI amphid neuron. Very very very weak and inconsistent expression in ASI (Sengupta Lab 2005). Low intenstiy GFP. | ||
Strain: BC14817 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00003725 |