Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5860

expand all nodes | collapse all nodes | view schema

Name Class

Expr5860Expression_ofGeneWBGene00006578
Reflects_endogenous_expression_ofWBGene00006578
HomolHomol_homolF25H2:Expr
Expression_data (2)
TypeReporter_gene[tli-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GAAAAGAATGCTGGGAAAAGTAAA] 3' and primer B 5' [CTCAGTATTCATTGTTTCTCACGG] 3'.
PatternAdult Expression: pharynx; intestine; anal depressor muscle; Reproductive System; vulval muscle; vulva other; spermatheca; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; neurons along body; tail neurons; unidentified cells in head; unidentified cells in tail ;
Larval Expression: pharynx; intestine; anal depressor muscle; Reproductive System; developing gonad; body wall muscle; hypodermis; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; neurons along body; tail neurons; unidentified cells in head; unidentified cells in tail ;
PictureWBPicture0000004905
RemarkStrain: BC13170
ReferenceWBPaper00006525
TransgeneWBTransgene00004462