Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5834

expand all nodes | collapse all nodes | view schema

Name Class

Expr5834Expression_of (2)
HomolHomol_homolF23B12:Expr
Expression_dataLife_stageWBls:0000041
WBls:0000023
Anatomy_term (11)
TypeReporter_gene[F23B12.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGCCATCTCATCCTTTCCCT] 3' and primer B 5' [GGGAACTTCGAGATTACCTGAATA] 3'.
PatternAdult Expression: pharynx; intestine; anal depressor muscle; Reproductive System; vulva other; body wall muscle; Nervous System; nerve ring; ventral nerve cord; unidentified cells in head; unidentified cells in tail ;
Larval Expression: pharynx; intestine; anal depressor muscle; body wall muscle; Nervous System; nerve ring; unidentified cells in head; unidentified cells in tail ;
RemarkAlso expressed in (comments from author) : GFP intensity is quite high, and it is difficult to distinguish some tissues.
Strain: BC11033
ReferenceWBPaper00006525
TransgeneWBTransgene00002455