WormBase Tree Display for Expr_pattern: Expr5827

Expr5827 Expression_of: Gene: WBGene00004006
    Reflects_endogenous_expression_of: WBGene00004006
  Homol: Homol_homol: F22E10:Expr
  Expression_data: Life_stage: WBls:0000003
      WBls:0000041
      WBls:0000023
    Anatomy_term: WBbt:0003681
      WBbt:0005733
      WBbt:0005739 Partial
        Remark: unidentified cells
      WBbt:0005741 Partial
        Remark: unidentified cells
      WBbt:0005772
      WBbt:0005812
  Type: Reporter_gene: [pgp-12::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTGCTTGCAGTGAACCAGAA] 3' and primer B 5' [TTACGCCACTTGATGTTTAACCTA] 3'.
  Pattern: Adult Expression: pharynx; hypodermis; excretory cell; unidentified cells in head; unidentified cells in tail ;
    Embryo Expression: intestine; excretory cell;
    Larval Expression: pharynx; excretory cell; unidentified cells in head;
  Remark: Also expressed in (comments from author) : unidentified cells in head and tail
    Strain: BC10210
  Reference: WBPaper00006525
  Transgene: WBTransgene00002070