Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5748

expand all nodes | collapse all nodes | view schema

Name Class

Expr5748Expression_ofGeneWBGene00008729
Reflects_endogenous_expression_ofWBGene00008729
HomolHomol_homolF13B12:Expr
Expression_data (2)
TypeReporter_gene[F13B12.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CAATCATTCAAATCGAAGCAAA] 3' and primer B 5' [CAAAGTTCGAACACTGGAAAAAG] 3'.
PatternAdult Expression: pharynx; intestine; vulval muscle; body wall muscle; hypodermis; excretory cell; Nervous System; neurons along body; unidentified cells in tail ;
Larval Expression: pharynx; intestine; body wall muscle; hypodermis; excretory cell; Nervous System; neurons along body; unidentified cells in tail ;
RemarkStrain: BC15489
ReferenceWBPaper00006525
TransgeneWBTransgene00003988