Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5689

expand all nodes | collapse all nodes | view schema

Name Class

Expr5689Expression_ofGeneWBGene00008585
Reflects_endogenous_expression_ofWBGene00008585
HomolHomol_homolF08G12:Expr
Expression_data (2)
TypeReporter_gene[F08G12.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTGTTCTAAGTTTTATGCGGTT] 3' and primer B 5' [TTGCGGAGAAGATCTGAATAATTT] 3'.
PatternAdult Expression: pharynx; intestine; anal depressor muscle; Reproductive System; uterine muscle; vulval muscle; spermatheca; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body;
Larval Expression: pharynx; intestine; anal depressor muscle; Reproductive System; developing vulva; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body;
RemarkStrain: BC14781
ReferenceWBPaper00006525
TransgeneWBTransgene00003711