WormBase Tree Display for Expr_pattern: Expr5618
expand all nodes | collapse all nodes | view schema
Expr5618 | Expression_of | Gene | WBGene00017042 | Inferred_automatically |
---|---|---|---|---|
Reflects_endogenous_expression_of | WBGene00017042 | |||
Homol | Homol_homol | D2007:Expr | ||
Expression_data (2) | ||||
Type | Reporter_gene | [D2007.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGCAAACGGACATACATCAAA] 3' and primer B 5' [CAGCGATTGATCCTGAACATTA] 3'. | ||
Pattern | Adult Expression: intestine; Nervous System; ventral nerve cord; head neurons; tail neurons; unidentified cells in head; | |||
Larval Expression: intestine; Nervous System; ventral nerve cord; head neurons; tail neurons; unidentified cells in head; | ||||
Remark | Also expressed in (comments from author) : Embryo incomplete. To be updated. | |||
Strain: BC12489 | ||||
Reference | WBPaper00006525 | |||
Transgene | WBTransgene00002946 | |||
Historical_gene | WBGene00017043 | Note: This object originally referred to WBGene00017043. WBGene00017043 is now considered dead and has been merged into WBGene00017042. WBGene00017042 has replaced WBGene00017043 accordingly. |