WormBase Tree Display for Expr_pattern: Expr5549
expand all nodes | collapse all nodes | view schema
Expr5549 | Expression_of (2) | ||
---|---|---|---|
Homol | Homol_homol | C50C3:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
Anatomy_term | WBbt:0005735 | ||
WBbt:0006751 | |||
Type | Reporter_gene | [C50C3.8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCTTTCTTTCCTTTGTTGTCAATG] 3' and primer B 5' [ATTGCGAATAAGTTTTACCTCTGT] 3'. | |
Pattern | Adult Expression: Nervous System; head neurons; unidentified cells; | ||
Remark | Also expressed in (comments from author) : incomplete. Will be updated. | ||
Strain: BC12487 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002945 |