WormBase Tree Display for Expr_pattern: Expr5515
expand all nodes | collapse all nodes | view schema
Expr5515 | Expression_of | Gene | WBGene00006001 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00006001 | ||
Homol | Homol_homol | F40H7:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term | WBbt:0005735 | ||
WBbt:0006753 | |||
WBbt:0006759 | |||
Type | Reporter_gene | [srx-110::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAGCAGGTGAAACTGGATCG] 3' and primer B 5' [AGTTACTCAAAAACATGGAAGTGA] 3'. | |
Pattern | Adult Expression: Nervous System; tail neurons; phasmids; | ||
Larval Expression: Nervous System; tail neurons; phasmids; | |||
Picture | WBPicture0000004267 | ||
Remark | Also expressed in (comments from author) : Expression is is seen from L3 stage and onward | ||
Strain: BC16049 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00004155 |