WormBase Tree Display for Expr_pattern: Expr5443
expand all nodes | collapse all nodes | view schema
Expr5443 | Expression_of | Gene | WBGene00016479 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00016479 | ||
Homol | Homol_homol | C36C5:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term | WBbt:0005394 | ||
WBbt:0005733 | |||
WBbt:0005735 | |||
WBbt:0006751 | |||
Type | Reporter_gene | [srab-6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGTGAAAAACAAAGTCACGAAAA] 3' and primer B 5' [CGGTATGATGTGATTTTAAATTGT] 3'. | |
Pattern | Adult Expression: hypodermis; Nervous System; head neurons; amphids; | ||
Larval Expression: hypodermis; Nervous System; head neurons; amphids; | |||
Picture | WBPicture0000004131 | ||
Remark | Also expressed in (comments from author) : Not amphid neurons, Not labial neuorns. Some kind of subcellular GFP (Cori Bergmann 2005). | ||
Strain: BC14733 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00003687 |