WormBase Tree Display for Expr_pattern: Expr5442
expand all nodes | collapse all nodes | view schema
Expr5442 | Expression_of (2) | ||
---|---|---|---|
Homol | Homol_homol | C36C5:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term | WBbt:0004292 | ||
WBbt:0005394 | |||
WBbt:0005735 | |||
WBbt:0005747 | |||
WBbt:0005772 | |||
WBbt:0005821 | |||
WBbt:0006751 | |||
Type | Reporter_gene | [srab-7::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AACTGAAGTTCCACCCATCG] 3' and primer B 5' [TCTTGATAGGAAGGGATCTGAAAT] 3'. | |
Pattern | Adult Expression: intestine; anal depressor muscle; Reproductive System; vulval muscle; Nervous System; head neurons; amphids; | ||
Larval Expression: intestine; Nervous System; head neurons; amphids; | |||
Picture | WBPicture0000004121 | ||
WBPicture0000004122 | |||
WBPicture0000004123 | |||
Remark | Also expressed in (comments from author) : ASH, ASI, + ASK amphid neurons. Strong and consistent signal for ASH. ASK and ASI signals are variable and not detectable in some worms (STein Lab 2005). | ||
Strain: BC14732 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00003686 |