WormBase Tree Display for Expr_pattern: Expr5439
expand all nodes | collapse all nodes | view schema
Expr5439 | Expression_of | Gene | WBGene00007969 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00007969 | ||
Homol | Homol_homol | C36A4:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term | WBbt:0005733 | ||
WBbt:0005735 | |||
WBbt:0005772 | |||
WBbt:0006749 | |||
WBbt:0006750 | |||
WBbt:0006751 | |||
Type | Reporter_gene | [C36A4.9::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATAGCCCAAAAAGGCCGAAT] 3' and primer B 5' [GAACGTCCGAGATGATGAGA] 3'. | |
Pattern | Adult Expression: intestine; hypodermis; Nervous System; nerve ring; head neurons; | ||
Larval Expression: intestine; Nervous System; nerve ring; dorsal nerve cord; head neurons; | |||
Picture | WBPicture0000009302 | ||
WBPicture0000009303 | |||
WBPicture0000009304 | |||
WBPicture0000009305 | |||
WBPicture0000009306 | |||
WBPicture0000009307 | |||
WBPicture0000009308 | |||
Remark | Also expressed in (comments from author) : Embryo incomplete. To be updated. | ||
Strain: BC10604 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00004263 |