WormBase Tree Display for Expr_pattern: Expr5421
expand all nodes | collapse all nodes | view schema
| Expr5421 | Expression_of | Gene | WBGene00000229 | ||
|---|---|---|---|---|---|
| Reflects_endogenous_expression_of | WBGene00000229 | ||||
| Homol | Homol_homol | C34E10:Expr | |||
| Expression_data | Life_stage | WBls:0000041 | |||
| WBls:0000023 | |||||
| Anatomy_term | WBbt:0003681 | ||||
| WBbt:0003822 | |||||
| WBbt:0003833 | |||||
| WBbt:0004292 | |||||
| WBbt:0005300 | |||||
| WBbt:0005733 | |||||
| WBbt:0005735 | |||||
| WBbt:0005738 | Partial | ||||
| Remark | unidentified cells | ||||
| WBbt:0005739 | Partial | ||||
| Remark | unidentified cells | ||||
| WBbt:0005741 | Partial | ||||
| Remark | unidentified cells | ||||
| WBbt:0005747 | |||||
| WBbt:0005812 | |||||
| WBbt:0005813 | |||||
| WBbt:0005821 | |||||
| WBbt:0006749 | |||||
| WBbt:0006751 | |||||
| WBbt:0006759 | |||||
| Type | Reporter_gene | [atp-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGAATTCTGCACTGCAATCAC] 3' and primer B 5' [TAACGAACGCGAAGCGATA] 3'. | |||
| Pattern | Adult Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; Reproductive System; vulval muscle; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells in head; unidentified cells in body ;unidentified cells in tail ; | ||||
| Larval Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells in head; unidentified cells in body ;unidentified cells in tail ; | |||||
| Remark | Also expressed in (comments from author) : Intense GFP expression made it hard to resolve some tissues. | ||||
| Strain: BC10161 | |||||
| Reference | WBPaper00006525 | ||||
| Transgene | WBTransgene00002116 |
