Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5416

expand all nodes | collapse all nodes | view schema

Name Class

Expr5416Expression_of (2)
HomolHomol_homolC34B2:Expr
Expression_dataLife_stageWBls:0000041
WBls:0000023
Anatomy_term (11)
TypeReporter_gene[C34B2.6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AACTGGAGCTGTTGATTTGACAT] 3' and primer B 5' [TCCAGCGCGGTAGATTTC] 3'.
PatternAdult Expression: pharynx; intestine; body wall muscle; hypodermis; seam cells; Nervous System; head neurons; unidentified cells in head; unidentified cells in tail ;
Larval Expression: pharynx; intestine; Reproductive System; developing vulva; body wall muscle; hypodermis; seam cells; Nervous System; head neurons; unidentified cells in head; unidentified cells in tail ;
RemarkStrain: BC14537
ReferenceWBPaper00006525
TransgeneWBTransgene00003594