WormBase Tree Display for Expr_pattern: Expr5395
expand all nodes | collapse all nodes | view schema
Expr5395 | Expression_of | Gene | WBGene00007834 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00007834 | ||
Homol | Homol_homol | C31A11:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term | WBbt:0003679 | ||
WBbt:0005394 | |||
WBbt:0005735 | |||
WBbt:0005772 | |||
WBbt:0006751 | |||
WBbt:0006753 | |||
WBbt:0006759 | |||
Type | Reporter_gene | [srxa-7::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCACTTCCAAGTACGGAAATACA] 3' and primer B 5' [GGAATGTGCTCAAAGATATTGATT] 3'. | |
Pattern | Adult Expression: intestine; Nervous System; head neurons; amphids; neurons along body; tail neurons; phasmids; | ||
Larval Expression: intestine; Nervous System; head neurons; amphids; neurons along body; tail neurons; phasmids; | |||
Picture | WBPicture0000009287 | ||
WBPicture0000009288 | |||
WBPicture0000009289 | |||
Remark | Also expressed in (comments from author) : ASG, ASH, + ASI amphid neurons; PHB phasmid neuron. PHB is bright and reproducible. Amphid neuron are all faint and unreliable. (Bargmann Lab 2005) | ||
Strain: BC14770 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00003705 |