WormBase Tree Display for Expr_pattern: Expr5376
expand all nodes | collapse all nodes | view schema
Expr5376 | Expression_of | Gene | WBGene00002827 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00002827 | ||
Homol | Homol_homol | C29E6:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term | WBbt:0005733 | ||
WBbt:0005735 | |||
WBbt:0005747 | |||
WBbt:0005753 | |||
WBbt:0005772 | |||
WBbt:0005800 | |||
WBbt:0005813 | |||
WBbt:0006748 | |||
WBbt:0006751 | |||
Type | Reporter_gene | [let-653::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAGTAGGTGGAGCGAAGCAA] 3' and primer B 5' [TTAGTGGATGTCGGATTTACTGAA] 3'. | |
Pattern | Adult Expression: intestine; Reproductive System; vulva other; body wall muscle; hypodermis; seam cells; | ||
Larval Expression: intestine; rectal epithelium; Reproductive System; developing vulva; body wall muscle; hypodermis; seam cells; Nervous System; head neurons; | |||
Picture (2) | |||
Remark | Also expressed in (comments from author) : The listed expression pattern was from June 2004. When viewed again, May 2005, there was only hypodermis in adults. | ||
Strain: BC10642 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002350 |