Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5320

expand all nodes | collapse all nodes | view schema

Name Class

Expr5320Expression_of (2)
HomolHomol_homolC24A11:Expr
Expression_dataLife_stageWBls:0000041
WBls:0000023
Anatomy_term (19)
TypeReporter_gene[frm-4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCTCAACTTGCTCCCAACTC] 3' and primer B 5' [TACCCCTGGAAACACGAAAA] 3'.
PatternAdult Expression: pharynx; intestine; stomato-intestinal muscle; Reproductive System; distal tip cell; vulval muscle; spermatheca; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; head neurons; neurons along body; unidentified cells in head; unidentified cells in tail ;
Larval Expression: pharynx; intestine; stomato-intestinal muscle; distal tip cell; developing vulva; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; head neurons; neurons along body; unidentified cells in head; unidentified cells in tail ;
PictureWBPicture0000003941
RemarkStrain: BC12301
ReferenceWBPaper00006525
TransgeneWBTransgene00004291