Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5308

expand all nodes | collapse all nodes | view schema

Name Class

Expr5308Expression_ofGeneWBGene00015978
Reflects_endogenous_expression_ofWBGene00015978
HomolHomol_homolC18F10:Expr
Expression_dataLife_stageWBls:0000041
WBls:0000023
Anatomy_term (16)
TypeReporter_gene[C18F10.7a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATCGTCAACCATCGTCTTCC] 3' and primer B 5' [GGGATTCCGCCTGAAAAT] 3'.
PatternAdult Expression: pharynx; intestine; rectal gland cells; anal depressor muscle; Reproductive System; vulval muscle; body wall muscle; head mesodermal cell; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons;
Larval Expression: pharynx; intestine; rectal gland cells; anal depressor muscle; Reproductive System; developing vulva; body wall muscle; head mesodermal cell; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons;
Picture (6)
RemarkAlso expressed in (comments from author) : No comments.
Strain: BC15500
ReferenceWBPaper00006525
TransgeneWBTransgene00003993