WormBase Tree Display for Expr_pattern: Expr5297
expand all nodes | collapse all nodes | view schema
Expr5297 | Expression_of | Gene | WBGene00015934 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00015934 | ||
Homol | Homol_homol | C17H12:Expr | |
Expression_data (2) | |||
Type | Reporter_gene | [C17H12.9::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCAGGTCCCTTCTGAATACAAC] 3' and primer B 5' [TTAAAGCATCGATTGTCGTTTG] 3'. | |
Pattern | Adult Expression: Reproductive System; vulval muscle; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; neurons along body; tail neurons; unidentified cells in head; unidentified cells in body ; | ||
Larval Expression: Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; neurons along body; tail neurons; unidentified cells in head; unidentified cells in body ; | |||
Remark | Also expressed in (comments from author) : unidentified cells in head and near vulva. | ||
Strain: BC10721 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00004304 |