Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5297

expand all nodes | collapse all nodes | view schema

Name Class

Expr5297Expression_ofGeneWBGene00015934
Reflects_endogenous_expression_ofWBGene00015934
HomolHomol_homolC17H12:Expr
Expression_data (2)
TypeReporter_gene[C17H12.9::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCAGGTCCCTTCTGAATACAAC] 3' and primer B 5' [TTAAAGCATCGATTGTCGTTTG] 3'.
PatternAdult Expression: Reproductive System; vulval muscle; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; neurons along body; tail neurons; unidentified cells in head; unidentified cells in body ;
Larval Expression: Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; neurons along body; tail neurons; unidentified cells in head; unidentified cells in body ;
RemarkAlso expressed in (comments from author) : unidentified cells in head and near vulva.
Strain: BC10721
ReferenceWBPaper00006525
TransgeneWBTransgene00004304