WormBase Tree Display for Expr_pattern: Expr5292
expand all nodes | collapse all nodes | view schema
Expr5292 | Expression_of | Gene | WBGene00015926 | ||
---|---|---|---|---|---|
Reflects_endogenous_expression_of | WBGene00015926 | ||||
Homol | Homol_homol | C17H11:Expr | |||
Expression_data | Life_stage | WBls:0000041 | |||
WBls:0000023 | |||||
Anatomy_term | WBbt:0003681 | ||||
WBbt:0005300 | |||||
WBbt:0005733 | |||||
WBbt:0005735 | |||||
WBbt:0005741 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0005747 | |||||
WBbt:0005767 | |||||
WBbt:0005772 | |||||
WBbt:0005800 | |||||
WBbt:0006748 | |||||
WBbt:0006751 | |||||
WBbt:0006759 | |||||
WBbt:0006760 | |||||
Type | Reporter_gene | [C17H11.6b::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTATTAAAAATGTTTGCGCCG] 3' and primer B 5' [CGTCGCTGTATGACCAACC] 3'. | |||
Pattern | Adult Expression: pharynx; pharyngeal-intestinal valve; intestine; rectal epithelium; Reproductive System; uterus; vulva other; hypodermis; Nervous System; ventral nerve cord; head neurons; tail neurons; unidentified cells in tail ; | ||||
Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; rectal epithelium; hypodermis; Nervous System; ventral nerve cord; head neurons; tail neurons; unidentified cells in tail ; | |||||
Picture | WBPicture0000003895 | ||||
WBPicture0000003896 | |||||
WBPicture0000003897 | |||||
Remark | Also expressed in (comments from author) : Neural in tail are the PHASMID GLIA i.e. socket cells (Hall Lab, 2005). | ||||
Strain: BC13998 | |||||
Reference | WBPaper00006525 | ||||
Transgene | WBTransgene00003363 |