WormBase Tree Display for Expr_pattern: Expr5281
expand all nodes | collapse all nodes | view schema
Expr5281 | Expression_of | Gene | WBGene00000430 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00000430 | ||
Expression_data | Life_stage | WBls:0000023 | |
Anatomy_term | WBbt:0005735 | ||
WBbt:0006749 | |||
WBbt:0006751 | |||
Type | Reporter_gene | [ceh-5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AATCAGTATCCTCTGCATCGGT] 3' and primer B 5' [GTATCGGCAGAAGGGATAGTTG] 3'. | |
Pattern | Larval Expression: Nervous System; nerve ring; head neurons; | ||
Picture (2) | |||
Remark | Also expressed in (comments from author) : Notes have been lost. 2 images taken and posted, appears neural. | ||
Strain: BC10763 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002380 |