WormBase Tree Display for Expr_pattern: Expr5268
expand all nodes | collapse all nodes | view schema
Expr5268 | Expression_of (2) | ||||
---|---|---|---|---|---|
Homol | Homol_homol | C15C7:Expr | |||
Expression_data | Life_stage | WBls:0000041 | |||
WBls:0000023 | |||||
Anatomy_term | WBbt:0005735 | ||||
WBbt:0005739 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0005753 | |||||
WBbt:0005772 | |||||
WBbt:0005798 | |||||
WBbt:0005800 | |||||
WBbt:0006751 | |||||
WBbt:0006759 | |||||
Type | Reporter_gene | [C15C7.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TATTTCAAAATTTCGCCTGAAAA] 3' and primer B 5' [TCGGTAGTTGCTGATTTTCACTAT] 3'. | |||
Pattern | Adult Expression: intestine; anal sphincter; seam cells; Nervous System; head neurons; tail neurons; unidentified cells in head; | ||||
Larval Expression: intestine; anal sphincter; rectal epithelium; seam cells; Nervous System; head neurons; tail neurons; unidentified cells in head; | |||||
Picture | WBPicture0000009246 | ||||
WBPicture0000009247 | |||||
WBPicture0000009248 | |||||
WBPicture0000009249 | |||||
WBPicture0000009250 | |||||
WBPicture0000009251 | |||||
Remark | Also expressed in (comments from author) : Unidentified in head might be amphid socket cells?Embryo incomplete. To be updated. | ||||
Strain: BC10468 | |||||
Reference | WBPaper00006525 | ||||
Transgene | WBTransgene00002271 |